human ace2 293t cells  (TaKaRa)

Journal: bioRxiv

Article Title: Staged heavy-chain filtering enables Fab discovery from combinatorially intractable library spaces

doi: 10.64898/2026.05.10.724059

Figure Lengend Snippet: (a, b) Binding ELISA curves and apparent half-maximal effective concentration (EC₅₀) values of CLR101 and reference antibodies (CR3022, P2B-2F6, and S309) against the SARS-CoV-2 D614G spike protein (a) and wild-type RBD (b) (n = 2 independent experiments, mean ± s.d.). (c) Apparent EC₅₀ values of CLR101, CR3022, P2B-2F6, and S309 against RBDs of six SARS-CoV-2 variants—wild-type (Wuhan-Hu-1), Alpha (B.1.1.7), Beta (B.1.351), Gamma (P.1), Delta (B.1.617.2), and BA.5 (B.1.1.529.5)—determined by ELISA (n = 2 independent experiments, mean ± s.d.). (d) Epitope binning analysis of CLR101 by competitive ELISA. The heatmap displays the mean percent inhibition of CLR101 binding to wild-type RBD in the presence of excess competitor proteins (ACE2, CLR101, CR3022, P2B-2F6, and S309). Self-competition by CLR101 was included as a positive control for binding inhibition. The color scale indicates the degree of inhibition from 0% to 100% (n = 3 independent experiments). (e, f) Evaluation of in vitro neutralizing activity against D614G spike-pseudotyped lentiviral particles using hACE2-293T cells. (e) Dose-response neutralization curve of CLR101, showing neutralizing activity with an apparent EC₅₀ of 11.1 ± 2.6 nM (n = 2 independent experiments, mean ± s.d.). (f) Percent neutralizing activity of CLR101 alongside benchmark antibodies at a fixed antibody concentration of 100 nM (n = 2 independent experiments, mean ± s.d.).

Article Snippet: Virus–antibody mixtures were then added to monolayers of hACE2-expressing 293T cells (hACE2-293T; Takara Bio Inc., Kusatsu, Shiga, Japan) in 96-well plates.

Techniques: Binding Assay, Enzyme-linked Immunosorbent Assay, Concentration Assay, Competitive ELISA, Inhibition, Positive Control, In Vitro, Activity Assay, Neutralization

Journal: JCI Insight

Article Title: Unbiased cleavage site prediction uncovers viral antagonism of host innate immunity by SARS-CoV-2 3C-like protease

doi: 10.1172/jci.insight.185739

Figure Lengend Snippet: ( A ) Identification of COVID-19 GWAS hits adjacent (± 150bp) to genomic locations of SARS-CoV-2 3CLPro cut sites. Log 10 Sarsport score shown on x axis, Log 10 P value of GWAS hits shown on y axis. Highlighted are clusters of high probability SNPs at high-scoring cut sites. ( B ) OAS1 isoforms COVID-19 GWAS SNPs. The p42 (major allele) isoform and p46 (minor alleles) are determine by a single SNP, rs10774671. A high scoring cut-site (Q384) is located 12 aa upstream of the C-terminus of the p46 OAS1 isoform, which encodes a prenylation site. ( C ) AlphaFold structure of full-length p46 OAS1 with predicted cut-site highlighted. ( D ) Western blot of 293T cells overexpressing p46 OAS1 and C145A (catalytically inactive) or active 3CLPro. Full-length (46 kDa) and cleaved product (44 kDa) highlighted. Strep-Tag and HSP90 controls were run on a separate gel from OAS1 staining. ( E ) Immunocytochemistry of 293T cells overexpressing p46 OAS1 and C145A or 3CLPro. Costaining with WGA shown to mark subcellular membrane structures. Scale bar: 10 μm. ( F ) Colocalization quantification of WGA and OAS1 from E . In total, 60–80 individual OAS1 + /3CLPro + or OAS1 + /C145A + cells were traced and colocalization quantified by Pearson’s R value of linear using the Coloc2 ImageJ plugin (NIH). Comparison statistics of R values quantified by 2-tailed Student’s t test. ( G ) Immunocytochemistry of ACE2-293T cells expressing V5 tagged p46 OAS. Costaining of V5 to mark OAS1 with WGA shown to mark subcellular membrane structures. Scale bar: 5 μm. ( H ) Colocalization quantification of WGA and OAS1 from control or COVID infected cells in G . Ten to 18 individual cells were traced and colocalization of WGA and OAS1 quantified by Pearson’s R value of linear using the Coloc2 ImageJ plugin. Comparison statistics of R values quantified by 2-tailed Student’s t test.

Article Snippet: For 293T overexpression assays, commercially available 293T (ATCC, catalog CRL 3216) or ACE2-293T (Takara, catalog 631289) were cultured according to manufacturer’s protocol.

Techniques: Western Blot, Strep-tag, Staining, Immunocytochemistry, Membrane, Comparison, Expressing, Control, Infection

Journal: Npj Gut and Liver

Article Title: Silencing of S100A11 attenuates murine metabolic dysfunction-associated steatohepatitis

doi: 10.1038/s44355-025-00044-w

Figure Lengend Snippet: A Representative BODIPY stained images from Hu1545 human hepatocyte cell line treated with palmitate (PA) with or without benitrobenrazide (BNBZ). The experiment was replicated 3 times. Vehicle control (Veh) included equivalent amounts of isopropanol and DMSO. Scale bar: 20 µm. B Quantification of BODIPY staining was performed in Image J. Each dot represents a separate experiment averaged over five fields. Approximately 16–36 cells were counted per field. Data were calculated as the mean intensity divided by the number of cells per field. ** P < 0.01, *** P < 0.001, **** P < 0.0001.

Article Snippet: S100A11 knockout cells were generated in the human Hu1545 cell line using Guide-it® CRISPR/Cas9 System (Takara Bio) with these single guide sequences 5’—AATTAGACAGAGTTCCTAAGCTTC and 3’—AATTGAAGCTTAGGAACTCTGTCT.

Techniques: Staining, Control